ApiaryActive
Try: pause · settings · learn · wipe
← Community / Reading Room
BD
knowledge · 15 min read

Bee Diseases Diagnosis

Honeybee colonies face a perfect storm: habitat loss, pesticide exposure, climate‑driven phenology shifts, and a suite of pathogens that exploit weakened…

Bee health is the pulse of our ecosystems, our farms, and the emerging world of self‑governing AI agents that depend on pollination services. Knowing how to spot the three most prevalent brood diseases—chalkbrood, American foulbrood (AFB), and European foulbrood (EFB)—can mean the difference between a thriving apiary and a cascading loss of colonies. This guide walks you through the visual cues you’ll see on the hive floor, the laboratory techniques that confirm what you suspect, and the decision‑making workflow that lets you act quickly, responsibly, and with confidence.


1. Why Accurate Diagnosis Matters

Honeybee colonies face a perfect storm: habitat loss, pesticide exposure, climate‑driven phenology shifts, and a suite of pathogens that exploit weakened hosts. In the United States alone, the USDA reported a 38 % decline in total colony numbers between 2015 and 2023, and brood diseases rank among the top three drivers of those losses. A single outbreak of American foulbrood can decimate a commercial operation—a single infected hive can spread to an entire apiary within 2–3 weeks if left unchecked.

For beekeepers, the stakes are practical: lost honey, reduced pollination fees, and costly eradication procedures. For conservationists, each infected colony reduces the pollination capacity of surrounding wild flora, threatening food security and biodiversity. For AI agents that model ecosystem services, inaccurate disease data corrupts predictions, leading to misguided resource allocation. A robust diagnostic protocol—grounded in visual inspection and backed by laboratory confirmation—provides the reliable data needed across all these domains.


2. Foundations of Bee‑Disease Diagnosis

Before diving into species‑specific protocols, it helps to understand the common workflow that underpins all diagnoses:

StepWhat it entailsTypical tools
1. Field reconnaissanceSystematic visual inspection of brood frames, honey stores, and adult bee behavior.Frame holder, magnifying glass (10×–20×), flashlight, field notebook.
2. Sample collectionRemoving suspect brood, larvae, or honey for lab work while preserving pathogen integrity.Sterile forceps, 2 ml cryovial, ethanol‑wiped containers, cool box.
3. Preliminary triageMatching visual signs to a shortlist of likely diseases.Decision matrix, reference images (e.g., bee disease atlas).
4. Laboratory confirmationMicroscopy, culture, PCR, or ELISA to identify the pathogen definitively.Light microscope, agar plates, thermocycler, commercial kits.
5. Reporting & actionDocumenting results, notifying authorities (if required), and implementing control measures.Digital forms, GIS tagging, API calls to bee health monitoring platforms.

The speed and accuracy of each step determine how quickly a beekeeper can intervene. Visual inspection is rapid but prone to mis‑identification; laboratory work eliminates ambiguity but takes 24–72 h. The best practice is to run both in parallel, using the field assessment to guide sample handling and the lab results to confirm or refute the hypothesis.


3. Chalkbrood (Ascosphaera apis) – Visual Diagnosis

3.1. The pathogen and its life cycle

Ascosphaera apis is a fungal parasite that primarily attacks honeybee larvae during the pre‑pupal stage (4–6 days old). Spores are ingested with contaminated pollen, germinate in the gut, and proliferate through the hemocoel, eventually killing the larva. The fungus produces a cotton‑like mummified larva that is the hallmark sign beekeepers look for.

Key statistics:

  • Incidence: In temperate regions, chalk‑brood prevalence ranges from 5 % to 20 % of colonies during wet springs.
  • Colony impact: In severe cases, 30–50 % of brood can be lost, but colonies often survive if the queen continues to lay.
  • Temperature sensitivity: Spores germinate best at 28–30 °C; colder hives (< 20 °C) suppress disease progression.

3.2. What you see on the frames

When you open a brood frame, look for the following visual cues:

  1. Mummified larvae – elongated, white to gray, with a cottony, fluffy surface that may be covered in fine spores. The mummified body often hangs from the cell wall rather than being fully sealed.
  2. Discoloration – the head may appear yellow‑brown while the rest of the body stays white.
  3. Absence of odor – unlike AFB, chalkbrood does not emit a strong, sour smell.
  4. Location pattern – chalkbrood tends to affect clusters of adjacent cells, especially in the lower brood area where temperature is cooler.

Field tip

Hold a suspected mummified larva with tweezers and gently press it between two glass slides. A faint, white, silky filament should emerge when you pull the slides apart—this is the fungal hyphae. If the filaments break easily, you’re likely looking at chalkbrood.

3.3. Differentiating from other brood diseases

FeatureChalkbroodAFBEFB
Spore typeCottony fungal sporesBacterial endospores (highly resistant)Bacterial cocci (no spores)
OdorNoneStrong, “rotting cheese”Slight, sour
Cell wall attachmentLarva often hangingLarva glued to cell wallLarva often collapsed, no glue
Temperature preference28–30 °C32–35 °C (spores survive colder)33–35 °C

When in doubt, move to laboratory confirmation (see Section 4).


4. Chalkbrood – Laboratory Confirmation

4.1. Sample handling

  1. Collect 5–10 mummified larvae from different frames to ensure representative sampling.
  2. Place each larva in a sterile 2 ml cryovial with a drop of sterile distilled water to keep spores moist.
  3. Label with hive ID, date, and location on frame.
  4. Keep samples cool (4–10 °C) and ship to the lab within 48 h. If shipping is delayed, store at ‑20 °C (spores tolerate freezing).

4.2. Microscopic examination

Procedure:

  • Place a larva on a glass slide, add a drop of lactophenol cotton blue stain, cover with a coverslip.
  • Observe under 100×–400× magnification.

What you should see:

  • Conidiophores – long, septate hyphae terminating in chains of conidia (spores) that appear oval to cylindrical, 5–10 µm long.
  • Spore clusters – dense aggregates that give the “cottony” look.

A positive identification is made when > 70 % of observed structures match the morphology described in the International Commission on Bee Disease (ICBD) guidelines.

4.3. Molecular confirmation (PCR)

While microscopy is usually sufficient, PCR provides species‑level certainty and can detect low‑level infections. A typical protocol:

ComponentDetails
Target geneITS region of the fungal ribosomal DNA
PrimersF‑ITS‑1 (5′‑GGAAGTAAAAGTCGTAACAAGG‑3′) / R‑ITS‑4 (5′‑TCCTCCGCTTATTGATATGC‑3′)
Thermal profile95 °C 5 min; 35 cycles of 95 °C 30 s, 58 °C 30 s, 72 °C 45 s; final 72 °C 5 min
DetectionAgarose gel (1.5 %) – a single ~600 bp band confirms A. apis

PCR sensitivity is ≈10 spores per reaction, making it useful for early detection before visual signs emerge.

4.4. Interpreting results

  • Positive – Visual signs + microscopy or PCR → chalkbrood confirmed.
  • Negative microscopy, positive PCR – Early infection; consider prophylactic treatment (e.g., thymol or oxalic acid).
  • Negative both – Re‑examine frames; may be another disease or a misidentified mummified larva.

5. American Foulbrood (Paenibacillus larvae) – Visual Diagnosis

5.1. Pathogen profile

Paenibacillus larvae is a Gram‑positive, spore‑forming bacterium that attacks larvae 12–36 h after they are laid. Spores are extraordinarily resilient: they survive for decades in honey, wax, and equipment. AFB is a reportable disease in most countries because of its potential for rapid spread and difficulty of eradication.

Key facts:

  • Global prevalence: AFB is present in > 90 % of surveyed apiaries in the United States, though most infections are low‑level.
  • Colony loss: A single infected hive, if untreated, can cause 80–100 % loss of an apiary within 4–6 weeks.
  • Spore load: In a severely infected brood, spore counts can exceed 10⁸ spores per gram of honey.

5.2. Visual hallmarks on the brood frame

  1. “Twisted” or “ropey” larvae – the dead larva becomes a yellow‑brown, rope‑like mass that can be pulled apart like a string.
  2. Odor – a distinct, foul, “rotting cheese” smell is often present; the scent intensifies with temperature.
  3. Cellular pattern – early infection shows “scale”—a thin layer of dead larvae covering the brood surface. In later stages, the “burst” pattern appears, where the cell wall ruptures and the mass spills out.
  4. Cap – the pupal cap may be amber to brown, contrasting with the pale color of healthy caps.
  5. Honeycomb discoloration – honey may appear yellow‑brown and contain a fine, powdery sediment of spores.

Field tip

Gently scrape a small piece of the suspect mass with a sterile needle. If it pulls away in a single, cohesive strand, you are likely dealing with AFB. The strand can be placed on a white filter paper; a powdery residue after a few minutes is a clue to the presence of spores.

5.3. Differentiating AFB from other diseases

FeatureAFBChalkbroodEFB
Spore presenceEndospores (heat‑resistant)Fungal spores (cottony)No spores
OdorStrong, sourNoneMild, sour
Cell ruptureOften “burst”RareRare
Temperature toleranceSpores survive < 4 °CSpores germinate at 28–30 °CBacteria proliferate at 33–35 °C

Because AFB is legally reportable, any suspicion should trigger immediate quarantine and a laboratory test (Section 6).


6. American Foulbrood – Laboratory Confirmation

6.1. Sample collection

  1. Select 2–3 suspect larvae (preferably the “rope” mass) and two honey samples (≈ 5 g each) from the same hive.
  2. Place each specimen in a separate sterile tube labeled with hive ID, date, and “AFB‑suspect”.
  3. Heat‑treat the honey sample at 65 °C for 30 min to reduce contaminating flora, then store at 4 °C.
  4. Ship to a certified diagnostic lab within 72 h; if longer, freeze at ‑20 °C (spores survive).

6.2. Microscopic detection of spores

Procedure:

  • Prepare a wet mount of a crushed larval sample in a drop of sterile saline.
  • Observe under 400× magnification.

What you should see:

  • Large, oval endospores (~ 1 µm × 0.5 µm) that appear brightly refractile against the background.
  • Chains of spores (often > 10 per chain) are characteristic.

A spore count > 10⁴ per ml of honey is considered a high‑risk infection per the USDA AFB guidelines.

6.3. Culture on selective media

Medium: MYPGP agar (Mannitol‑Yeast‑Peptone‑Glucose‑Polymyxin).

Incubation: 35 °C for 48–72 h under aerobic conditions.

Colony morphology: Flat, irregular, gray‑white colonies that become white‑gray after 48 h.

Confirmation: Perform a Gram stainP. larvae appears Gram‑positive rods in chains.

6.4. Molecular detection (real‑time PCR)

Real‑time PCR is the gold standard for rapid AFB confirmation. Recommended assay (based on the CDC AFB qPCR protocol):

ComponentDetails
Target geneplc (phosphatidylinositol‑specific phospholipase C)
PrimersF‑AFB‑plc (5′‑GCTGATCCTGATGCTGCTTT‑3′) / R‑AFB‑plc (5′‑CTGCCATGATGAGTTGGTTG‑3′)
Probe5′‑FAM‑AGCCTGCTTCCGAG‑BHQ1‑3′
Thermal profile95 °C 3 min; 40 cycles of 95 °C 15 s, 60 °C 60 s
Detection limit≈ 10 spores/reaction

A Ct value < 30 indicates a heavy infection; Ct 30–35 suggests low‑level presence.

6.5. Interpreting results

Lab outcomeAction
Positive microscopy + cultureConfirmed AFB – immediate quarantine, notify authorities, consider burn or sterilization of equipment.
Positive PCR, negative cultureEarly infection – monitor closely, treat with oxytetracycline (if legal) and enhance hive hygiene.
Negative allRe‑evaluate field signs; could be chalkbrood or a non‑infectious brood anomaly.

Because AFB spores can survive decades, beekeepers must treat any positive detection with strict biosecurity.


7. European Foulbrood (Melissococcus plutonius) – Visual Diagnosis

7.1. Pathogen overview

Melissococcus plutonius is a Gram‑positive, facultative anaerobe that attacks young larvae (12–48 h old). Unlike AFB, EFB does not produce spores, making it less persistent in the environment but more sensitive to colony conditions such as nutrition, temperature, and humidity.

Statistics:

  • Incidence: In Europe, EFB prevalence is 12–18 % of apiaries; in the U.S., it accounts for ≈ 5 % of brood disease cases.
  • Colony loss: In severe outbreaks, up to 30 % of brood can be lost, but colonies often survive with proper management.
  • Temperature optimum: 33–35 °C; cooler temperatures (< 30 °C) suppress bacterial growth.

7.2. Visual cues on the brood frame

  1. “Jelly‑like” larvae – infected larvae become soft, translucent, and watery; they may appear yellow‑green when illuminated.
  2. Capped larvae – the cappings often turn brownish and may be slightly raised.
  3. “Pin‑point” lesions – small, pin‑point dark spots appear on the larval cuticle, sometimes described as “small black dots”.
  4. Absence of odor – EFB typically lacks the strong smell associated with AFB.
  5. Pattern of infection – EFB frequently spreads laterally across rows of cells, creating a “streak” appearance.

Field tip

Use a 10× magnifying glass to view the capped cell from the side. A transparent, watery interior that collapses under slight pressure is a strong indicator of EFB.

7.3. Distinguishing EFB from AFB and chalkbrood

FeatureEFBAFBChalkbrood
Spore formationNonePresent (endospores)Fungal spores
OdorMinimalStrong, sourNone
Larval consistencyWatery, translucentRope‑like, mushyCottony, dry
Temperature optimum33–35 °C32–35 °C (spores survive colder)28–30 °C
Cell ruptureRareCommon (burst)Rare

8. European Foulbrood – Laboratory Confirmation

8.1. Sample acquisition

  1. Collect 5–8 diseased larvae (preferably still capped) and place each in a sterile 2 ml tube with a few drops of sterile saline.
  2. Label with hive ID, date, and “EFB‑suspect”.
  3. Keep samples on ice (4 °C) and ship within 48 h; if delayed, store at ‑20 °C (bacteria survive short‑term freezing).

8.2. Microscopy and Gram staining

Procedure:

  • Homogenize one larva in 10 µl of sterile saline.
  • Smear onto a glass slide, air‑dry, heat‑fix, and apply a Gram stain.

What you should see:

  • Gram‑positive cocci arranged in short chains or pairs, often intra‑cellular within the larval hemolymph.
  • No spore structures.

A positive Gram stain combined with the visual field signs is a strong indicator of EFB, but confirmation is recommended.

8.3. Culture on selective media

Medium: KSBHI agar (Kanamycin‑Sodium Salts‑Brain‑Heart Infusion) supplemented with 5 % sheep blood.

Incubation: 35 °C under microaerophilic conditions (e.g., GasPak™) for 48–72 h.

Colony morphology: Small, translucent, gray‑white colonies with a weak β‑hemolysis on blood agar.

Biochemical test: Catalase‑negative, oxidase‑negative, urease‑positive.

8.4. Molecular detection (PCR)

Target the 16S rRNA gene specific to M. plutonius.

ComponentDetails
PrimersF‑Mpl‑16S (5′‑GCTAGTTTGCTGATGAGAGC‑3′) / R‑Mpl‑16S (5′‑CCATCTTGCTTCTTCCATCA‑3′)
Thermal profile95 °C 5 min; 35 cycles of 95 °C 30 s, 58 °C 30 s, 72 °C 45 s; final 72 °C 5 min
DetectionAgarose gel (1 %) – a single ~1.2 kb band confirms M. plutonius
Sensitivity≈ 100 CFU per reaction

A positive PCR with matching culture results confirms EFB.

8.5. Interpreting the laboratory data

Lab outcomeRecommended response
Positive microscopy + cultureConfirmed EFB – treat with tetracycline (if permitted) and improve nutrition (e.g., pollen substitutes).
Positive PCR, negative cultureEarly infection – consider antibiotic prophylaxis and hygiene interventions.
All negativeRe‑examine field signs; could be a non‑infectious brood abnormality or a mixed infection (e.g., AFB + EFB).

9. Integrated Decision‑Making: From Field to Lab to Action

9.1. A workflow diagram (textual)

  1. Daily inspection → document any abnormal brood.
  2. Preliminary identification using the visual key (Sections 3, 5, 7).
  3. Sample collection → label, store, and ship to lab.
  4. Laboratory results (microscopy, culture, PCR) → receive within 24–72 h.
  5. Decision engine (human + AI).
  • Rule‑based: If AFB confirmed → mandatory quarantine + report to bee health monitoring.
  • Probabilistic: If chalkbrood PCR Ct > 30 → low‑level infection → monitor.
  • AI‑assisted: Use image‑recognition models trained on thousands of brood photos (e.g., bee disease AI classifier) to flag ambiguous cases.
  1. Implement control measures → chemical treatment, hive splitting, or destruction.
  2. Post‑treatment verification → repeat sampling after 2 weeks to confirm pathogen clearance.

9.2. Role of AI agents

Modern apiaries increasingly employ self‑governing AI agents that ingest field data, run diagnostics, and suggest interventions. These agents can:

  • Aggregate visual reports from dozens of beekeepers into a real‑time disease map.
  • Predict outbreak hotspots using climate data (temperature, humidity) and spore persistence models.
  • Recommend targeted sampling locations to minimize labor while maximizing detection probability.

However, AI is only as reliable as the ground‑truth data it receives. Accurate visual identification and proper sample handling (as outlined in this guide) are essential for training and validation. A feedback loop—where lab‑confirmed results are fed back into the AI system—creates a virtuous cycle that improves both diagnostic precision and conservation outcomes.

9.3. Legal and ethical considerations

  • Reporting: In the U.S., Canada, EU, and many other jurisdictions, AFB is a notifiable disease. Failure to report can result in fines and increased spread.
  • Antibiotic stewardship: Tetracycline and oxytetracycline are restricted in many countries due to concerns about resistance. Use only when disease is laboratory‑confirmed and after consulting local regulations.
  • Data privacy: When uploading hive data to a cloud platform, ensure that personal identifiers are anonymized unless the beekeeper consents to share.

10. Prevention, Monitoring, and Long‑Term Management

10.1. Hygienic practices that curb all three diseases

PracticeHow it helps
Regular comb replacement (replace old brood frames every 2–3 years)Removes accumulated spores (AFB) and fungal inoculum (chalkbrood).
Drone brood removalDrone cells are often a reservoir for P. larvae spores; removing them reduces spore load.
Ventilation and temperature controlMaintaining 33 °C in the brood area discourages chalkbrood (prefers cooler) and supports healthy larval development.
Nutrient supplementation (high‑quality pollen, protein patties)Strong colonies are less susceptible to EFB, which thrives under nutritional stress.
Sanitation of equipment (burning, autoclaving)Spores of P. larvae are killed at 121 °C for 15 min; thorough cleaning reduces cross‑contamination.

10.2. Monitoring protocols

  • Monthly brood checks during the active season (April–October).
  • Quarterly lab testing of a random 5 % sample of colonies for sub‑clinical infections.
  • Seasonal risk assessment using climate forecasts—high humidity and warm springs increase chalkbrood risk; warm, dry summers favor AFB outbreaks.

10.3. Integrating with conservation initiatives

Many conservation programs (e.g., wild pollinator corridors) depend on healthy managed hives to supplement wild bee populations. By keeping disease prevalence low, beekeepers contribute to genetic diversity and pollination resilience across landscapes. Moreover, data from diagnostic protocols can be shared (with consent) to build regional disease dashboards, informing policymakers where to allocate resources for habitat restoration or disease mitigation.


Why it matters

Bee diseases are not isolated veterinary problems; they ripple through agriculture, ecosystems, and the emerging field of AI‑driven environmental stewardship. A clear, evidence‑based diagnostic pathway—starting with the sharp eyes of a beekeeper, refined by microscopic and molecular confirmation, and amplified by intelligent data platforms—gives us the tools to protect colonies before they collapse. When we catch chalkbrood, American foulbrood, or European foulbrood early, we preserve honey production, safeguard pollination services, and keep the data streams that power conservation AI accurate. In short, diagnosis is the first line of defense, and defense is the foundation of a thriving, resilient future for bees and the humans and machines that rely on them.

Frequently asked
What is Bee Diseases Diagnosis about?
Honeybee colonies face a perfect storm: habitat loss, pesticide exposure, climate‑driven phenology shifts, and a suite of pathogens that exploit weakened…
What should you know about 1. Why Accurate Diagnosis Matters?
Honeybee colonies face a perfect storm: habitat loss, pesticide exposure, climate‑driven phenology shifts, and a suite of pathogens that exploit weakened hosts. In the United States alone, the USDA reported a 38 % decline in total colony numbers between 2015 and 2023 , and brood diseases rank among the top three…
What should you know about 2. Foundations of Bee‑Disease Diagnosis?
Before diving into species‑specific protocols, it helps to understand the common workflow that underpins all diagnoses:
What should you know about 3.1. The pathogen and its life cycle?
Ascosphaera apis is a fungal parasite that primarily attacks honeybee larvae during the pre‑pupal stage (4–6 days old) . Spores are ingested with contaminated pollen, germinate in the gut, and proliferate through the hemocoel, eventually killing the larva. The fungus produces a cotton‑like mummified larva that is the…
What should you know about 3.2. What you see on the frames?
When you open a brood frame, look for the following visual cues:
References & sources
  1. Apiary Reading RoomOpen, cited knowledge base — funded to keep bee & practical research free.
From the Apiary Reading Room. Opinion & editorial — not financial advice. We don't overclaim.
More from the Reading Room